Publications
1,25-dihydroxyvitamin D-responsive element and glucocorticoid repression in the osteocalcin gene
Abstract
The active hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3[1,25(OH), which regulates cellular replication and function in many tissues and has a role in bone and calcium homeostasis, acts through a hormone receptor homologous with other steroid and thyroid hormone receptors. A 1,25(OH)2D3-responsive element (VDRE), which is within the promoter for osteocalcin [a bone protein induced by 1,25(OH)2D3] is unresponsive to other steroid hormones, can function in a heterologous promoter, and contains a doubly palindromic DNA sequence (TTGGTGACTCACCGGGTGAAC; -513 to -493 bp), with nucleotide sequence homology to other hormone responsive elements. The potent glucocorticoid repression of 1,25(OH)2D3 induction and of basal activity of this promoter acts through a region between -196 and +34 bp, distinct from the VDRE.
| Type | Journal |
|---|---|
| ISBN | 0036-8075 (Print) |
| Authors | Morrison, N. A.;Shine, J.;Fragonas, J. C.;Verkest, V.;McMenemy, M. L.;Eisman, J. A. : |
| Responsible Garvan Author | Professor John Shine |
| Publisher Name | SCIENCE |
| Published Date | 1989-01-01 |
| Published Volume | 246 |
| Published Issue | 4934 |
| Published Pages | 1158-61 |
| Status | Published in-print |
| URL link to publisher's version | http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Citation&list_uids=2588000 |